Review



tlcv2 backbone  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc tlcv2 backbone
    Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tlcv2 backbone/product/Addgene inc
    Average 96 stars, based on 130 article reviews
    tlcv2 backbone - by Bioz Stars, 2026-04
    96/100 stars

    Images



    Similar Products

    tlcv2 backbone  (Addgene inc)
    96
    Addgene inc tlcv2 backbone
    Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tlcv2 backbone/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    tlcv2 backbone - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier
    tlcv2 loxp backbone  (Addgene inc)
    93
    Addgene inc tlcv2 loxp backbone

    Tlcv2 Loxp Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tlcv2 loxp backbone/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    tlcv2 loxp backbone - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    lentiviral backbone tlcv2 backbone  (Addgene inc)
    93
    Addgene inc lentiviral backbone tlcv2 backbone

    Lentiviral Backbone Tlcv2 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral backbone tlcv2 backbone/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lentiviral backbone tlcv2 backbone - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    lentiviral backbone  (Addgene inc)
    96
    Addgene inc lentiviral backbone

    Lentiviral Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral backbone/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    lentiviral backbone - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier
    tlcv2 plasmid backbone  (Addgene inc)
    96
    Addgene inc tlcv2 plasmid backbone

    Tlcv2 Plasmid Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tlcv2 plasmid backbone/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    tlcv2 plasmid backbone - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Versatile roles of annexin A4 in clear cell renal cell carcinoma: Impact on membrane repair, transcriptional signatures, and composition of the tumor microenvironment

    doi: 10.1016/j.isci.2025.112198

    Figure Lengend Snippet:

    Article Snippet: Guide sequences (non-targeting – nt-sgRNA-1: 5′- GCGGGCAGAACGACCCTGAC -3', nt-sgRNA-2: 5′- GAAGACGTGCTGGCGTCACC -3'; ANXA4-targeting – ANXA4-sg1: TCTGCTGGCTATAGGTAAGC(TGG), ANXA4-sg2: GGACGATGCTCTCGTGAGAC(AGG) - (PAM sequence in brackets)) were cloned into TLCV2-LoxP backbone (TLCV2-LoxP was a gift from Adam Karpf (Addgene plasmid #127098; http://n2t.net/addgene:127098; RRID:Addgene_127098).

    Techniques: Virus, Generated, Recombinant, Membrane, Electron Microscopy, Saline, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, Western Blot, RNA Sequencing, Gene Expression, Imaging, Plasmid Preparation, shRNA, Control, Luciferase, Cloning, Expressing, Software, Cell Analysis, Microscopy, Cell Culture